Review



li cor image studio acquisition software  (LI-COR)


Bioz Verified Symbol LI-COR is a verified supplier
Bioz Manufacturer Symbol LI-COR manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    LI-COR li cor image studio acquisition software
    Li Cor Image Studio Acquisition Software, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 550 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/li+cor+image+studio+software/Odyssey+CLx+Image+Studio+Analysis+Software+-+In-Cell+Western+Add-On/pm41995846-101-12-18
    Average 98 stars, based on 550 article reviews
    li cor image studio acquisition software - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Software:

    Article Title: Chromatin association promotes UBR5-mediated degradation of Rb
    Article Snippet: The primary antibodies were detected using the fluorescently labeled secondary antibodies IRDye® 680LT Goat anti-Mouse IgG (LI-COR 926-68020) and IRDye® 800CW Goat anti-Rabbit IgG (LI-COR 926-32211). .. Membranes were imaged on a LI-COR Odyssey CLx and analyzed with LI-COR Image Studio software. .. The following primary antibodies were used: anti-Rb (Santa Cruz, sc-74570, 1:500), anti-HDAC1 (CST#5356, 1:1000).

    Article Title: GlycoRNA complexed with heparan sulfate regulates VEGF-A signalling.
    Article Snippet: The membranes were scanned on a LI-COR Odyssey CLx scanner (LI-COR Biosciences). .. Images were acquired using LI-COR Image Studio software. .. Of Protein-G beads, 5 μl was pre-conjugated with 1 μg of anti-VEGF-A antibody (Proteintech) in samples buffer for 1 h at 4 °C.

    Article Title: Tau, amyloid-β and α-synuclein co-pathologies synergistically enhance neuroinflammation and hippocampal neuron loss.
    Article Snippet: IRDye-conjugated secondary antibodies (Mouse IRDye 680: LI-COR 926–68,070; Rabbit IRDye 800: LI-COR 926–32,211) were used at 1:2000 for 1 h at ambient temperatures. .. Blots were imaged using a LI-COR Odyssey CLx system and analyzed using LI-COR Image studio software. .. For iontophoretic microinjections, mice were anesthetized with Fatal Plus (Vortech Pharmaceuticals, Catalog #0298–9373-68) and transcardially perfused with cold 1% paraformaldehyde (PFA; Sigma Aldrich, Catalog #P6148) for 1 min, followed by 4% PFA with 0.125% glutaraldehyde (Fisher Scientific, Catalog #BP2547) for 10 min. A peristaltic pump (Cole Parmer) was used for consistent administration of cold PFA.

    Article Title: Quantitative and temporal analysis of autophagy: Differential Response to amino acid and glucose starvation
    Article Snippet: .. Protein bands imaged using LI-COR Odyssey Infrared Imaging System and quantified with LI-COR Image Studio Software. .. Fluorescent cells (2.5 x 10 4 cells per chamber) were seeded in 4-chamber 35 mm CELLview dishes with glass bottom (Greiner Bio-One, 627870) and allowed to settle for 48 hours before imaging.

    Article Title: The Mycobacterium tuberculosis ESX-5 secretion system enables carbon source utilization and growth in mice.
    Article Snippet: Membranes were washed with PBST-20, then probed for 1 h with horseradish peroxidase-conjugated secondary antibody (goat antirabbit IgG 31466 or goat antimouse IgG 31431, Thermo Fisher) at 1:10,000 dilution in PBST-20 with 2.5% non-fat milk powder. .. Membranes were washed with PBST-20, incubated for 5 min with SuperSignal Pico West chemiluminescent substrate (Thermo Fisher), and immediately imaged using an Odyssey Fc Imaging System (LI-COR) with LI-COR Image Studio software. ..

    Article Title: Compositions and methods for use in immunotherapy
    Article Snippet: .. The gels were imaged with a LI-COR Odyssey CLx and quantified using the LI-COR Image Studio software or imaged with a Cytiva Typhoon and quantified using the Cytiva IQTL software. .. DNA oligos with the sequence TGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTC GCGCT (non-target strand, NTS (SEQ ID NO: 596)) and TGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTC GCGCT (target strand, TS (SEQ ID NO: 597)) were purchased with 5′ fluorescent labels (LI-COR IRDye 700 and 800, respectively).

    Article Title: GlycoRNA complexed with heparan sulfate regulates VEGF-A signalling.
    Article Snippet: Membranes were finally rinsed in 1× PBS and scanned on a LI-COR Odyssey CLx scanner. .. Images and intensity of bands were acquired using LI-COR Image Studio software. .. The primary antibodies used were: mouse monoclonal anti-EXT2 (sc-514092, Santa Cruz; immunoblot 1:1,000), anti-EXT1 (sc-515144, Santa Cruz; immunoblot 1:1,000), mouse monoclonal anti-GAPDH (sc-47724, Santa Cruz; immunoblot 1:1,000), rabbit polyclonal anti-GFP (A11122, Invitrogen; immunoblot 1:1,000), mouse monoclonal anti-NDST1 (sc100790, Santa Cruz; immunoblot 1:1,000), mouse monoclonal anti-HS6ST1 (sc-398231, Santa Cruz; immunoblot 1:1,000), mouse monoclonal anti-HS2ST1 (sc-376530, Santa Cruz; immunoblot 1:1,000), rabbit monoclonal anti-phospho-p44/42 MAPK (Erk1/2(Thr202/Tyr204); 4370S, Cell Signaling Technology, immunoblot 1:500), mouse monoclonal anti-p44/42 MAPK (Erk1/2; 4696S, Cell Signaling Technology; immunoblot 1:500), rabbit monoclonal anti-phospho-VEGFR2(Tyr1175) (2478S, Cell Signaling Technology; immunoblot 1:500), rabbit polyclonal anti-VEGFR2 (26415-AP, Proteintech; immunoblot 1:500), mouse monoclonal anti-HA (sc-7392, Santa Cruz; immunoblot 1:1,000), rabbit polyclonal anti-DDX21 (NB100-1718, Novus Biologicals; immunoblot 1:500), rabbit polyclonal anti-hnRNP-U (14599-1-AP, Proteintech; immunoblot 1:500) and rabbit polyclonal anti-WNT3A (26744-1-AP, Proteintech; immunoblot 1:500).

    Article Title: Compositions and methods for use in immunotherapy
    Article Snippet: .. The gels were either imaged with a LI-COR Odyssey CLx and quantified using the LI-COR Image Studio software or imaged with a Cytiva Typhoon and quantified using the Cytiva IQTL software. ..

    Imaging:

    Article Title: Quantitative and temporal analysis of autophagy: Differential Response to amino acid and glucose starvation
    Article Snippet: .. Protein bands imaged using LI-COR Odyssey Infrared Imaging System and quantified with LI-COR Image Studio Software. .. Fluorescent cells (2.5 x 10 4 cells per chamber) were seeded in 4-chamber 35 mm CELLview dishes with glass bottom (Greiner Bio-One, 627870) and allowed to settle for 48 hours before imaging.

    Article Title: The Mycobacterium tuberculosis ESX-5 secretion system enables carbon source utilization and growth in mice.
    Article Snippet: Membranes were washed with PBST-20, then probed for 1 h with horseradish peroxidase-conjugated secondary antibody (goat antirabbit IgG 31466 or goat antimouse IgG 31431, Thermo Fisher) at 1:10,000 dilution in PBST-20 with 2.5% non-fat milk powder. .. Membranes were washed with PBST-20, incubated for 5 min with SuperSignal Pico West chemiluminescent substrate (Thermo Fisher), and immediately imaged using an Odyssey Fc Imaging System (LI-COR) with LI-COR Image Studio software. ..

    Incubation:

    Article Title: The Mycobacterium tuberculosis ESX-5 secretion system enables carbon source utilization and growth in mice.
    Article Snippet: Membranes were washed with PBST-20, then probed for 1 h with horseradish peroxidase-conjugated secondary antibody (goat antirabbit IgG 31466 or goat antimouse IgG 31431, Thermo Fisher) at 1:10,000 dilution in PBST-20 with 2.5% non-fat milk powder. .. Membranes were washed with PBST-20, incubated for 5 min with SuperSignal Pico West chemiluminescent substrate (Thermo Fisher), and immediately imaged using an Odyssey Fc Imaging System (LI-COR) with LI-COR Image Studio software. ..



    Similar Products

    98
    LI-COR li cor image studio acquisition software
    Li Cor Image Studio Acquisition Software, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/li+cor+image+studio+software/Odyssey+CLx+Image+Studio+Analysis+Software+-+In-Cell+Western+Add-On/pm41995846-101-12-18
    Average 98 stars, based on 1 article reviews
    li cor image studio acquisition software - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    LI-COR li cor odyssey clx
    Li Cor Odyssey Clx, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/li+cor+image+studio+software/Odyssey+CLx+Image+Studio+Analysis+Software+-+In-Cell+Western+Add-On/bio_rxiv__64898__2026__04__17__719278-190-4-4
    Average 98 stars, based on 1 article reviews
    li cor odyssey clx - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    LI-COR li cor image studio software
    Li Cor Image Studio Software, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/li+cor+image+studio+software/Odyssey+CLx+Image+Studio+Analysis+Software+-+In-Cell+Western+Add-On/bio_rxiv__64898__2026__04__16__719064-350-11-11
    Average 98 stars, based on 1 article reviews
    li cor image studio software - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    LI-COR li cor odyssey clx instrument
    Li Cor Odyssey Clx Instrument, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/li+cor+image+studio+software/Odyssey+CLx+Image+Studio+Analysis+Software+-+In-Cell+Western+Add-On/bio_rxiv__64898__2026__04__13__718206-174-64-64
    Average 98 stars, based on 1 article reviews
    li cor odyssey clx instrument - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    Nikon products software nis elements image studio li cor
    Products Software Nis Elements Image Studio Li Cor, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/li+cor+image+studio+software/NIS-Elements/pm41903528-624-130-128
    Average 99 stars, based on 1 article reviews
    products software nis elements image studio li cor - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    LI-COR li cor image studio lite software
    Li Cor Image Studio Lite Software, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/li+cor+image+studio+software/Odyssey+CLx+Image+Studio+Analysis+Software+-+In-Cell+Western+Add-On/10__1016_slash_j__heliyon__2026__e44653-104-17-17
    Average 98 stars, based on 1 article reviews
    li cor image studio lite software - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results